Fix swapped start/end in allele validation test#692
Merged
jdeligt merged 1 commit intoga4gh:2.1.0-connect_2026_#10from Apr 13, 2026
Merged
Fix swapped start/end in allele validation test#692jdeligt merged 1 commit intoga4gh:2.1.0-connect_2026_#10from
jdeligt merged 1 commit intoga4gh:2.1.0-connect_2026_#10from
Conversation
The 20bp insertion test case (NC_000001.11:156114976:CGCTGTCGCCCA:...) had start=156114988 and end=156114976, which is inverted. Start should be less than or equal to end in interbase coordinates.
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Sign up for free
to join this conversation on GitHub.
Already have an account?
Sign in to comment
2 participants
Add this suggestion to a batch that can be applied as a single commit.This suggestion is invalid because no changes were made to the code.Suggestions cannot be applied while the pull request is closed.Suggestions cannot be applied while viewing a subset of changes.Only one suggestion per line can be applied in a batch.Add this suggestion to a batch that can be applied as a single commit.Applying suggestions on deleted lines is not supported.You must change the existing code in this line in order to create a valid suggestion.Outdated suggestions cannot be applied.This suggestion has been applied or marked resolved.Suggestions cannot be applied from pending reviews.Suggestions cannot be applied on multi-line comments.Suggestions cannot be applied while the pull request is queued to merge.Suggestion cannot be applied right now. Please check back later.
Summary
NC_000001.11:156114976:CGCTGTCGCCCA:CGCTGTCGCCCAGCCGGGTGCGCTGTCGCCCAinvalidation/alleles.yamlhadstart=156114988andend=156114976(start > end), which is invalid for interbase coordinates.start=156114976,end=156114988.Found while running validation tests against a Rust VRS implementation.